Cover image provided by X3DNA-DSSR, an NIGMS National Resource for structural bioinformatics of nucleic acids (R24GM153869; skmatics.x3dna.org). Image generated using DSSR and PyMOL (Lu XJ. 2020. [Nucleic Acids Res 48: e74(https://doi.org/10.1093/nar/gkaa426)).
See the 2020 paper titled "DSSR-enabled innovative schematics of 3D nucleic acid structures with PyMOL" in Nucleic Acids Research and the corresponding Supplemental PDF for details. Many thanks to Drs. Wilma Olson and Cathy Lawson for their help in the preparation of the illustrations.
Details on how to reproduce the cover images are available on the 3DNA Forum.
Structure of a group II intron ribonucleoprotein in the pre-ligation state (PDB id: 8T2R; Xu L, Liu T, Chung K, Pyle AM. 2023. Structural insights into intron catalysis and dynamics during splicing. Nature 624: 682–688). The pre-ligation complex of the Agathobacter rectalis group II intron reverse transcriptase/maturase with intron and 5′-exon RNAs makes it possible to construct a picture of the splicing active site. The intron is depicted by a green ribbon, with bases and Watson-Crick base pairs represented as color-coded blocks: A/A-U in red, C/C-G in yellow, G/G-C in green, U/U-A in cyan; the 5′-exon is shown by white spheres and the protein by a gold ribbon. Cover image provided by X3DNA-DSSR, an NIGMS National Resource for structural bioinformatics of nucleic acids (R24GM153869; skmatics.x3dna.org). Image generated using DSSR and PyMOL (Lu XJ. 2020. Nucleic Acids Res 48: e74).
Complex of terminal uridylyltransferase 7 (TUT7) with pre-miRNA and Lin28A (PDB id: 8OPT; Yi G, Ye M, Carrique L, El-Sagheer A, Brown T, Norbury CJ, Zhang P, Gilbert RJ. 2024. Structural basis for activity switching in polymerases determining the fate of let-7 pre-miRNAs. Nat Struct Mol Biol 31: 1426–1438). The RNA-binding pluripotency factor LIN28A invades and melts the RNA and affects the mechanism of action of the TUT7 enzyme. The RNA backbone is depicted by a red ribbon, with bases and Watson-Crick base pairs represented as color-coded blocks: A/A-U in red, C/C-G in yellow, G/G-C in green, U/U-A in cyan; TUT7 is represented by a gold ribbon and LIN28A by a white ribbon. Cover image provided by X3DNA-DSSR, an NIGMS National Resource for structural bioinformatics of nucleic acids (R24GM153869; skmatics.x3dna.org). Image generated using DSSR and PyMOL (Lu XJ. 2020. Nucleic Acids Res 48: e74).
Cryo-EM structure of the pre-B complex (PDB id: 8QP8; Zhang Z, Kumar V, Dybkov O, Will CL, Zhong J, Ludwig SE, Urlaub H, Kastner B, Stark H, Lührmann R. 2024. Structural insights into the cross-exon to cross-intron spliceosome switch. Nature 630: 1012–1019). The pre-B complex is thought to be critical in the regulation of splicing reactions. Its structure suggests how the cross-exon and cross-intron spliceosome assembly pathways converge. The U4, U5, and U6 snRNA backbones are depicted respectively by blue, green, and red ribbons, with bases and Watson-Crick base pairs shown as color-coded blocks: A/A-U in red, C/C-G in yellow, G/G-C in green, U/U-A in cyan; the proteins are represented by gold ribbons. Cover image provided by X3DNA-DSSR, an NIGMS National Resource for structural bioinformatics of nucleic acids (R24GM153869; skmatics.x3dna.org). Image generated using DSSR and PyMOL (Lu XJ. 2020. Nucleic Acids Res 48: e74).
Structure of the Hendra henipavirus (HeV) nucleoprotein (N) protein-RNA double-ring assembly (PDB id: 8C4H; Passchier TC, White JB, Maskell DP, Byrne MJ, Ranson NA, Edwards TA, Barr JN. 2024. The cryoEM structure of the Hendra henipavirus nucleoprotein reveals insights into paramyxoviral nucleocapsid architectures. Sci Rep 14: 14099). The HeV N protein adopts a bi-lobed fold, where the N- and C-terminal globular domains are bisected by an RNA binding cleft. Neighboring N proteins assemble laterally and completely encapsidate the viral genomic and antigenomic RNAs. The two RNAs are depicted by green and red ribbons. The U bases of the poly(U) model are shown as cyan blocks. Proteins are represented as semitransparent gold ribbons. Cover image provided by X3DNA-DSSR, an NIGMS National Resource for structural bioinformatics of nucleic acids (R24GM153869; skmatics.x3dna.org). Image generated using DSSR and PyMOL (Lu XJ. 2020. Nucleic Acids Res 48: e74).
Structure of the helicase and C-terminal domains of Dicer-related helicase-1 (DRH-1) bound to dsRNA (PDB id: 8T5S; Consalvo CD, Aderounmu AM, Donelick HM, Aruscavage PJ, Eckert DM, Shen PS, Bass BL. 2024. Caenorhabditis elegans Dicer acts with the RIG-I-like helicase DRH-1 and RDE-4 to cleave dsRNA. eLife 13: RP93979. Cryo-EM structures of Dicer-1 in complex with DRH-1, RNAi deficient-4 (RDE-4), and dsRNA provide mechanistic insights into how these three proteins cooperate in antiviral defense. The dsRNA backbone is depicted by green and red ribbons. The U-A pairs of the poly(A)·poly(U) model are shown as long rectangular cyan blocks, with minor-groove edges colored white. The ADP ligand is represented by a red block and the protein by a gold ribbon. Cover image provided by X3DNA-DSSR, an NIGMS National Resource for structural bioinformatics of nucleic acids (R24GM153869; skmatics.x3dna.org). Image generated using DSSR and PyMOL (Lu XJ. 2020. Nucleic Acids Res 48: e74).
Moreover, the following 30 [12(2021) + 12(2022) + 6(2023)] cover images of the RNA Journal were generated by the NAKB (nakb.org).
Cover image provided by the Nucleic Acid Database (NDB)/Nucleic Acid Knowledgebase (NAKB; nakb.org). Image generated using DSSR and PyMOL (Lu XJ. 2020. Nucleic Acids Res 48: e74).
Recently I came across the ligand thiamine pyrophosphate (TPP) in some RNA riboswitch structures. I was a bit surprised by the atom names adopted for the ligand by the PDB. See figures below for the chemical structure of TPP from the RCSB PDB website (first), and the three-dimensional structure of the ligand from the riboswitch 2gdi (second).
Specifically, the planar base-like moiety at the right has atom names ending with prime. To my knowledge, only sugar atom names of DNA and RNA nucleotides have the prime suffix, such as the 2′-hydroxyl group in RNA.
The RCSB webpage for TPP shows that currently there are 107 entries in the PDB, among which 100 are from proteins, 6 from RNA, and one in a RNA-protein complex. It is not clear to me whether the prime-bearing names in TPP are following any documented ‘standard’ or convention. DSSR is nevertheless taking a note of such ‘weird’ cases.
As of today, the number of registered users on the 3DNA Forum has reached 2000. Over the past three years, the annual average of resignations is 650, corresponding to approximately 1.8 per day. While many registrations use free email services (gmail, hotmail or yahoo, etc), a significant portion (especially more recent ones) employs their job email (e.g., .edu). This is clear sign of increasing trust the community puts in the Forum.
To ensure the 3DNA Forum spam-free, I’ve adhered a zero-tolerance policy of any trolling or suspicion activities. The anti-spam software has played a big role in making this clean status feasible, as is evident from the note: “120,933 Spammers blocked up until today”.
From a scientific perspective, all posted questions have been addressed promptly, normally within hours. Instead of feeling like a burden, maintaining the Forum and answering user questions have been a pleasure. I’d love to see more questions or posts on the Forum.
The v1.2.1 (2015feb01) release of DSSR contains a new functionality to characterize the so-called H-type pseudoknots. In this classical and most common type of pseudoknots, nucleotides from a hairpin loop form Watson-Crick base pairs with a single-stranded region outside of the hairpin to create another (adjacent) stem, as shown in the following illustration (taken from the Huang et al. paper A heuristic approach for detecting RNA H-type pseudoknots).
Normally, L2 is absent (i.e., with zero nucleotides) due to direct coaxial stacking of the two stems. An example output of DSSR on 1ymo (a human telomerase RNA pseudoknot) is shown below:
The corresponding sections from DSSR output are:
****************************************************************************
List of 3 H-type pseudoknot loop segments
1 stem#1(hairpin#1) vs stem#2(hairpin#2) L1 groove=MAJOR nts=8 UUUUUCUC U7,U8,U9,U10,U11,C12,U13,C14
2 stem#1(hairpin#1) vs stem#2(hairpin#2) L2 groove=----- nts=0
3 stem#1(hairpin#1) vs stem#2(hairpin#2) L3 groove=minor nts=8 CAAACAAA C30,A31,A32,A33,C34,A35,A36,A37
****************************************************************************
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>1ymo-1-A #1 nts=47 [chain] RNA
GGGCUGUUUUUCUCGCUGACUUUCAGCCCCAAACAAAAAAGUCAGCA
[[[[[[........(((((((((]]]]]]........))))))))).
Checking against the three-dimensional image and the secondary structure in linear form shown above, the meaning of the new section should be obvious. If you want to see more details, click the link to the DSSR-output file on 1ymo.
Recently I came across the following two citations to DSSR:
Base pair types were annotated with RNAview (45,46). Hydrogen bonds were annotated manually and with the help of DSSR of the 3DNA package (47,48). Helix parameters were obtained using the Curves+ web server (49). Structural figures were prepared using PyMol (50).
It is interesting to note that DSSR is cited here for its identification of hydrogen bonds, not its annotation of base pairs, among many other features. The simple geometry-based H-bonding identification algorithm, originally implemented in find_pair/analyze of 3DNA (and adopted by RNAView) and highly refined in DSSR, works well for nucleic acid structures. With the --get-hbonds option, users can now use DSSR as a tool just for its list of H-bonds outside of the program.
All figures were generated using PyMOL (60) or Chimera (48). The secondary structure diagram of the human mitoribosomal RNA was prepared by extracting base pairs from the model using DSSR (61). The secondary structure diagram was drawn in VARNA (62) and finalized in Inkscape.
I am very pleased to see that DSSR was cited for its ‘intended’ use in this important piece of work from a leading laboratory in structural biology. In the middle of last November (2013), I was approached by the lead author for proper citation of DSSR, and I suggested the two 3DNA papers. As far as I can remember, this was the first time I received such a question on DSSR citation. It prompted to write a FAQ entry in the DSSR User Manual, titled “How to cite DSSR?”. Hopefully, this citation issue will be gone in the near future.
Over the past two years, I’ve devoted significant efforts to make DSSR a handy tool for RNA structural bioinformatics; it certainly represents my view as to what a scientific software program should be like. As time passes by, DSSR is becoming increasingly sophisticated and citations to DSSR can only be higher.
Recently, PDB begins to release atomic coordinates of large (ribosomal) structures in mmCIF format. For nucleic-acid-containing structures, the largest one so far is 4v4g, the crystal structure of five 70S ribosomes from Escherichia coli in complex with protein Y. It is assembled from ten PDB entries (1voq, 1vor, 1vos, 1vou, 1vov, 1vow, 1vox, 1voy, 1voz, 1vp0), consisting of 22,345 nucleotides, and a total of 717,805 atoms.
This humongous structure poses no problems to DSSR at all, as shown below.
Command: x3dna-dssr -i=4v4g.cif -o=4v4g.out
Processing file '4v4g.cif' [4v4g]
total number of base pairs: 9277
total number of multiplets: 918
total number of helices: 1099
total number of stems: 1221
total number of isolated WC/wobble pairs: 603
total number of atom-base stacking interactions: 1736
total number of hairpin loops: 504
total number of bulges: 170
total number of internal loops: 775
total number of junctions: 214
total number of non-loop single-stranded segments: 429
total number of kissing loops: 5
total number of A-minor (type I and II) motifs: 100
total number of ribose zippers: 58 (1159)
total number of kink turns: 39
Time used: 00:00:10:45
It took less than 11 minutes to run on an iMac (and nearly 14 minutes on a Ubuntu Linux machine). Given the
With great pleasure, I read the following annoancement from Rajendra Kumar on the 3DNA Forum:
Re: do_x3dna: a tool to analyze DNA/RNA in molecular dynamics trajectories
« Reply #1 on: Today at 10:53:31 AM »
Hello,
I have now made a new website for do_x3dna
(http://rjdkmr.github.io/do_x3dna). This website contains detailed
documentation for do_x3dna program and Python APIs.
Documentation for Python API is now available
(http://rjdkmr.github.io/do_x3dna/apidoc.html).
Few tutorials about the Python APIs are also now available
(http://rjdkmr.github.io/do_x3dna/tutorial.html).
Thanks.
With best regards,
Rajendra
Browsing through the do_x3dna website, I am impressed by the extensive documentation and tutorial. Clearly, do_x3dna has pushed the boundaries (in applicability and documentation) of the x3dna_ensemble Ruby script distributed with 3DNA v2.1.
As noted in GitHub page, do_x3dna has been developed to analyze fluctuations in DNA or RNA structures in molecular dynamics (MD) trajectories. It can be used for GROMACS MD trajectories, as well as those from NAMD and AMBER. It leaves no doubt that do_x3dna will boost 3DNA’s applications in the increasingly active field of DNA/RNA MD simulations.
From early on, 3DNA and DSSR have native support of modified nucleotides. The currently distributed baselist.dat file with 3DNA contains over 700 entries. As of v1.1.4-2014aug09, a new section has been added to DSSR to list explicitly the modified nucleotides in an analyzed structure.
Using the 76-nucleotide long yeast phenylalanine tRNA (1ehz) as an example, the pertinent section in DSSR output is as below.
List of 11 types of 14 modified nucleotides
nt count list
1 1MA-a 1 A.1MA58
2 2MG-g 1 A.2MG10
3 5MC-c 2 A.5MC40,A.5MC49
4 5MU-t 1 A.5MU54
5 7MG-g 1 A.7MG46
6 H2U-u 2 A.H2U16,A.H2U17
7 M2G-g 1 A.M2G26
8 OMC-c 1 A.OMC32
9 OMG-g 1 A.OMG34
10 PSU-P 2 A.PSU39,A.PSU55
11 YYG-g 1 A.YYG37
So 1ehz has 14 modified nucleotides of 11 different type, as listed in the following rows after the header line. The meaning of each column should be obvious. For example, the third row means that 5MC (5-methylcytidine, abbreviated as 'c' in 1-letter code) occurs twice, identified as A.5MC40 and A.5MC49, respectively.
With the 3-letter id, one can search the RCSB ligand database for more information about a specified modified nucleotide. The URL would be like this, using pseudouridine (PSU) as an example, https://www.rcsb.org/ligand/PSU.
It is hoped that the newly added section, put at the very top of DSSR output, will draw more attention to modified nucleotides.
From v1.1.3-2014jun18, DSSR has an additional output of RNA secondary structures in BPSEQ format. A sample file for PDB entry 1msy is shown below.
![1msy [GUAA tetra loop] in 3d and 2d representations](http://forum.x3dna.org/images/1msy-3d-2d.png "1msy [GUAA tetra loop] in 3d and 2d representations")
Filename: dssr-2ndstrs.bpseq
Organism: DSSR-derived secondary structure [1msy]
Accession Number: DSSR v1.1.4-2014aug09 (xiangjun@x3dna.org)
Citation: Please cite 3DNA/DSSR (see http://x3dna.org)
1 U 0 # name=A.U2647
2 G 26 # name=A.G2648, pairedNt=A.U2672
3 C 25 # name=A.C2649, pairedNt=A.G2671
4 U 24 # name=A.U2650, pairedNt=A.A2670
5 C 23 # name=A.C2651, pairedNt=A.G2669
6 C 22 # name=A.C2652, pairedNt=A.G2668
7 U 0 # name=A.U2653
8 A 0 # name=A.A2654
9 G 0 # name=A.G2655
10 U 0 # name=A.U2656
11 A 0 # name=A.A2657
12 C 17 # name=A.C2658, pairedNt=A.G2663
13 G 0 # name=A.G2659
14 U 0 # name=A.U2660
15 A 0 # name=A.A2661
16 A 0 # name=A.A2662
17 G 12 # name=A.G2663, pairedNt=A.C2658
18 G 0 # name=A.G2664
19 A 0 # name=A.A2665
20 C 0 # name=A.C2666
21 C 0 # name=A.C2667
22 G 6 # name=A.G2668, pairedNt=A.C2652
23 G 5 # name=A.G2669, pairedNt=A.C2651
24 A 4 # name=A.A2670, pairedNt=A.U2650
25 G 3 # name=A.G2671, pairedNt=A.C2649
26 U 2 # name=A.U2672, pairedNt=A.G2648
27 G 0 # name=A.G2673
Based on online sources, BPSEQ has originated from the Comparative RNA Web site developed by the Gutell lab. CRW files contain four header lines, describing the file name, organism, accession number, and a general remark. Thereafter, there is one line per base in the molecule, listing the position of the base (starting from 1), the one-letter base name (A,C,G,U etc), and the position number of the base to which it is paired. If the base is unpaired, zero (0) is put in the third column. In the above sample BPSEQ file derived from DSSR, detailed information about the base and its paired base (if any) comes after the # symbol.
Compared to dot-bracket notation (dbn) and connect-table (.ct) format, BPSEQ is simpler but less expressive. Nevertheless, the format is well-supported in bioinformatic tools on RNA secondary structures. It only seems fitting that DSSR now produces secondary structures in .bpseq (with default file name dssr-2ndstrs.bpseq), in addition to .dbn and .ct. Technically, adding the BPSEQ output to DSSR is trivial given the infrastructure already in place.
From early on, DSSR-derived RNA secondary structures in dot-bracket notation (dbn) have taken pseudoknots into consideration. Nevertheless, in DSSR releases prior to v1.1.3-2014jun18, the dbn output had been simplified to the first level only, with matched []s, even for RNA structures with high-order pseudoknots. RNA pseudoknot is a (relatively) complicated issue, and I’d planned to put off the topic until DSSR is well-established.
In early May, I noticed the Antczak et al. article RNApdbee—a webserver to derive secondary structures from pdb files of knotted and unknotted RNAs. I was delighted to read the following citation:
In order to facilitate a more comprehensive study, the webserver integrates the functionality of RNAView, MC-Annotate and 3DNA/DSSR, being the most common tools used for automated identification and classification of RNA base pairs.
Even before any paper on DSSR has been published, the software has already be ranked in the top three for the identification and classification of RNA base pairs! Well familiar with RNAView and MC-Annotate, I am glad to see DSSR is now listed on a par with them. Note that DSSR has far more functionality than just identifying and classifying RNA base pairs.
Further down the RNApdbee paper, especially in Figure 2, I found the following remarks regarding DSSR’s capability on RNA structures with high-order pseudoknot.
An arc diagram to represent the secondary structure of 1DDY (chain A) generated by R-CHIE upon the dot-bracket notation. Arcs of the same colour define a paired region. Crossing arcs reflect a conflict observed between the corresponding regions. (a) RNApdbee recognizes pseudoknots of the first (dark green) and second (navy blue) order. (b) 3DNA/DSSR improperly classifies base pairs (within residues in red) and the structure is recognized as the first-order pseudoknot.
The above citation and the question Higher-order pseudoknots in DP output (from Jan Hajic, Charles University in Prague) on the 3DNA Forum prompted me to further refine DSSR’s algorithm for deriving secondary structures of RNA with high-order pseudoknots. The DSSR v1.1.3-2014jun18 release made this revised functionality explicit. For the above cited PDB entry 1ddy, the relevant output of running DSSR on it would be:
Running command: "x3dna-dssr -i=1ddy.pdb"
****************************************************************************
This structure contains 2-order pseudoknot(s)
****************************************************************************
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>1ddy nts=140 [whole]
GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA&GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA&GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA&GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA
......(((.{[[....[[)))...].].}.]]..&......(((.{[[....[[)))...].].}.]]..&......(((.{[[....[[)))...].].}.]]..&......(((.{[[....[[)))...].].}.]]..
>1ddy-A #1 nts=35 [chain] RNA
GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA
......(((.{[[....[[)))...].].}.]]..
>1ddy-C #2 nts=35 [chain] RNA
GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA
......(((.{[[....[[)))...].].}.]]..
>1ddy-E #3 nts=35 [chain] RNA
GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA
......(((.{[[....[[)))...].].}.]]..
>1ddy-G #4 nts=35 [chain] RNA
GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA
......(((.{[[....[[)))...].].}.]]..
Note that the whole 1ddy entry contains four RNA chains (A, C, E, and G), and DSSR can handle each properly. So at least from DSSR v1.1.3-2014jun18, the following statement is no longer valid:
3DNA/DSSR improperly classifies base pairs (within residues in red) and the structure is recognized as the first-order pseudoknot.
A closely related issue is knot removal, a topic nicely summarized by Smit et al. in their publication From knotted to nested RNA structures: A variety of computational methods for pseudoknot removal. While not explicitly documented, the --nested (abbreviated to --nest) option has been available since DSSR v1.1.3-2014jun18. This option was first mentioned in the release note of DSSR v1.1.4-2014aug09. Again, using PDB entry 1ddy as an example, the relevant output of running DSSR with option --nested is as follows:
Running command: "x3dna-dssr -i=1ddy.pdb --nested"
****************************************************************************
This structure contains 2-order pseudoknot(s)
o You've chosen to remove pseudo-knots, leaving only nested pairs
****************************************************************************
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>1ddy nts=140 [whole]
GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA&GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA&GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA&GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA
......(((..........))).............&......(((..........))).............&......(((..........))).............&......(((..........))).............
>1ddy-A #1 nts=35 [chain] RNA
GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA
......(((..........))).............
>1ddy-C #2 nts=35 [chain] RNA
GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA
......(((..........))).............
>1ddy-E #3 nts=35 [chain] RNA
GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA
......(((..........))).............
>1ddy-G #4 nts=35 [chain] RNA
GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA
......(((..........))).............
