From early on, DSSR-derived RNA secondary structures in dot-bracket notation (dbn) have taken pseudoknots into consideration. Nevertheless, in DSSR releases prior to v1.1.3-2014jun18, the dbn output had been simplified to the first level only, with matched []s, even for RNA structures with high-order pseudoknots. RNA pseudoknot is a (relatively) complicated issue, and I’d planned to put off the topic until DSSR is well-established.
In early May, I noticed the Antczak et al. article RNApdbee—a webserver to derive secondary structures from pdb files of knotted and unknotted RNAs. I was delighted to read the following citation:
In order to facilitate a more comprehensive study, the webserver integrates the functionality of RNAView, MC-Annotate and 3DNA/DSSR, being the most common tools used for automated identification and classification of RNA base pairs.
Even before any paper on DSSR has been published, the software has already be ranked in the top three for the identification and classification of RNA base pairs! Well familiar with RNAView and MC-Annotate, I am glad to see DSSR is now listed on a par with them. Note that DSSR has far more functionality than just identifying and classifying RNA base pairs.
Further down the RNApdbee paper, especially in Figure 2, I found the following remarks regarding DSSR’s capability on RNA structures with high-order pseudoknot.
An arc diagram to represent the secondary structure of 1DDY (chain A) generated by R-CHIE upon the dot-bracket notation. Arcs of the same colour define a paired region. Crossing arcs reflect a conflict observed between the corresponding regions. (a) RNApdbee recognizes pseudoknots of the first (dark green) and second (navy blue) order. (b) 3DNA/DSSR improperly classifies base pairs (within residues in red) and the structure is recognized as the first-order pseudoknot.
The above citation and the question Higher-order pseudoknots in DP output (from Jan Hajic, Charles University in Prague) on the 3DNA Forum prompted me to further refine DSSR’s algorithm for deriving secondary structures of RNA with high-order pseudoknots. The DSSR v1.1.3-2014jun18 release made this revised functionality explicit. For the above cited PDB entry 1ddy, the relevant output of running DSSR on it would be:
Running command: "x3dna-dssr -i=1ddy.pdb"
****************************************************************************
This structure contains 2-order pseudoknot(s)
****************************************************************************
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>1ddy nts=140 [whole]
GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA&GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA&GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA&GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA
......(((.{[[....[[)))...].].}.]]..&......(((.{[[....[[)))...].].}.]]..&......(((.{[[....[[)))...].].}.]]..&......(((.{[[....[[)))...].].}.]]..
>1ddy-A #1 nts=35 [chain] RNA
GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA
......(((.{[[....[[)))...].].}.]]..
>1ddy-C #2 nts=35 [chain] RNA
GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA
......(((.{[[....[[)))...].].}.]]..
>1ddy-E #3 nts=35 [chain] RNA
GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA
......(((.{[[....[[)))...].].}.]]..
>1ddy-G #4 nts=35 [chain] RNA
GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA
......(((.{[[....[[)))...].].}.]]..
Note that the whole 1ddy entry contains four RNA chains (A, C, E, and G), and DSSR can handle each properly. So at least from DSSR v1.1.3-2014jun18, the following statement is no longer valid:
3DNA/DSSR improperly classifies base pairs (within residues in red) and the structure is recognized as the first-order pseudoknot.
A closely related issue is knot removal, a topic nicely summarized by Smit et al. in their publication From knotted to nested RNA structures: A variety of computational methods for pseudoknot removal. While not explicitly documented, the --nested (abbreviated to --nest) option has been available since DSSR v1.1.3-2014jun18. This option was first mentioned in the release note of DSSR v1.1.4-2014aug09. Again, using PDB entry 1ddy as an example, the relevant output of running DSSR with option --nested is as follows:
Running command: "x3dna-dssr -i=1ddy.pdb --nested" **************************************************************************** This structure contains 2-order pseudoknot(s) o You've chosen to remove pseudo-knots, leaving only nested pairs **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >1ddy nts=140 [whole] GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA&GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA&GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA&GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA ......(((..........))).............&......(((..........))).............&......(((..........))).............&......(((..........)))............. >1ddy-A #1 nts=35 [chain] RNA GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA ......(((..........)))............. >1ddy-C #2 nts=35 [chain] RNA GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA ......(((..........)))............. >1ddy-E #3 nts=35 [chain] RNA GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA ......(((..........)))............. >1ddy-G #4 nts=35 [chain] RNA GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA ......(((..........))).............
