DSSR analysis of the class V GTP aptamer-GTP complex structure

Recently, I came across the NAR breakthrough article titled 'Crystal Structure of the Class V GTP-Binding RNA Aptamer Bound to Its Ligand: GTP Recognition by a Topologically Complex Intermolecular G-Quadruplex' by Stafflinger et al. (2025). I read the paper carefully several times and really enjoyed both the content and the writing style. This work offers new insights into the structural complexities and ligand recognition capabilities of RNA. The 1.6-Å high-resolution X-ray crystal structure (PDB id: 9hrf) of the aptamer–GTP complex explains why the class V GTP aptamer has a particularly high affinity and specificity for GTP: The GTP ligand is integrated into one layer of a two-layered G-quadruplex, which is extended on one side by a UUGA tetrad and on the other side by a Watson–Crick base pair (C48–G52) that is stacked by an unpaired adenine (A49). Please see the figure below for further details.

DSSR can readily analyze this complex structure, by simply running the following command:

x3dna-dssr -i=9hrf.pdb --pair-water -o=9hrf.out

The --pair-water option enables the detection of water-mediated base pairs. For instance, it identifies the G41-water-A45 interaction, which is highlighted both below and within the UUGA tetrad shown in the lower left-corner of the figure above.

Base pairs

In total, DSSR identifies 37 base pairs, including:

  • A7-G62 imino pair (A-G Imino 08-VIII cWW cW-W)
  • U9+U10 platform (U+U Platform -- cSH cm+M)
  • U9+G41 reverse wobble (U+G rWobble 27-XXVII tWW tW+W)
  • Pseudo-knotted U10-A45 interaction (U-A WC 20-XX cWW cW-W) along with two G-tetrads forming G12+G46 and G13+G47 pairs (G+G -- 06-VI cHW cM+W)
  • U29+G32 in the apical tetra-loop (U+G -- -- tSW tm+W)
  • Water-mediated G41-A45 pairing (G-A Water -- cHH cM-M)
  • Watson-Crick C48-G52 pair (C-G WC 19-XIX cWW cW-W)

Note how DSSR's automatically derived pair names help orient readers to structural features, particularly stretches of Watson-Crick base pairs forming stems. DSSR categorizes base pairs using the widely accepted Saenger nomenclature and the Leontis-Westhof (LW) scheme. Moreover, it provides 3DNA/DSSR's unique M+N versus M–N distinction, which, along with a set of six parameters, allows for a rigorous characterization of base-pairing geometries.

DSSR also identifies isolated canonical base pairs that do not belong to any stem. In the PDB structure 9hrf, these are U10-A45 and C48-G52 (see below and in the upper-right corner of the figure above).

List of 37 base pairs
     nt1            nt2            bp  name        Saenger   LW   DSSR
   7 A.A7           A.G62          A-G Imino       08-VIII   cWW  cW-W
   9 A.U9           A.U10          U+U Platform    --        cSH  cm+M
  10 A.U9           A.G41          U+G rWobble     27-XXVII  tWW  tW+W
  11 A.U10          A.A45          U-A WC          20-XX     cWW  cW-W
  12 A.G12          A.G46          G+G --          06-VI     cHW  cM+W
  15 A.G13          A.G47          G+G --          06-VI     cHW  cM+W
  31 A.U29          A.G32          U+G --          --        tSW  tm+W
  33 A.G41          A.A45          G-A Water       --        cHH  cM-M
  37 A.C48          A.G52          C-G WC          19-XIX    cWW  cW-W

Multiplets

DSSR identifies three multiplets, the first two of which are illustrated in the figure above.

List of 3 multiplets
   1 nts=4 UUGA A.U9,A.U10,A.G41,A.A45
   2 nts=4 GGGg A.G12,A.G42,A.G46,A.GTP100
   3 nts=4 GGGG A.G13,A.G40,A.G43,A.G47

Stems, helices, and coaxial stacks

DSSR identifies three stems composed of (6, 8, 7) canonical pairs, each featuring continuous backbones. These three stems are coaxially arranged into a 23-pair-long helix through base-stacking interactions, irrespective of the type of base pair and the backbone connectivity (see below). The two additional base pairs within the 23-pair-long helix are the A7-G62 imino pair and the U29+G32 pair located in the apical tetra-loop. DSSR's geometric approach for identifying stems and helices aligns well with visual inspection, as demonstrated in the upper-left panel of the figure above.

  Note: a helix is defined by base-stacking interactions, regardless of bp
        type and backbone connectivity, and may contain more than one stem.
      helix#number[stems-contained] bps=number-of-base-pairs in the helix
      bp-type: '|' for a canonical WC/wobble pair, '.' otherwise
      helix-form: classification of a dinucleotide step comprising the bp
        above the given designation and the bp that follows it. Types
        include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices,
        '.' for an unclassified step, and 'x' for a step without a
        continuous backbone.
      --------------------------------------------------------------------
  helix#1[3] bps=23
      strand-1 5'-GGGCGCAUAGGUCGGUCGCUGCU-3'
       bp-type    ||||||.|||||||||||||||.
      strand-2 3'-CCCGUGGAUCCGGUCAGUGACGG-5'
      helix-form  AAA..AxAAA....xA..AAA.
   1 A.G1           A.C68          G-C WC           19-XIX    cWW  cW-W
   2 A.G2           A.C67          G-C WC           19-XIX    cWW  cW-W
   3 A.G3           A.C66          G-C WC           19-XIX    cWW  cW-W
   4 A.C4           A.G65          C-G WC           19-XIX    cWW  cW-W
   5 A.G5           A.U64          G-U Wobble       28-XXVIII cWW  cW-W
   6 A.C6           A.G63          C-G WC           19-XIX    cWW  cW-W
   7 A.A7           A.G62          A-G Imino        08-VIII   cWW  cW-W
   8 A.U14          A.A60          U-A WC           20-XX     cWW  cW-W
   9 A.A15          A.U59          A-U WC           20-XX     cWW  cW-W
  10 A.G16          A.C58          G-C WC           19-XIX    cWW  cW-W
  11 A.G17          A.C57          G-C WC           19-XIX    cWW  cW-W
  12 A.U18          A.G56          U-G Wobble       28-XXVIII cWW  cW-W
  13 A.C19          A.G55          C-G WC           19-XIX    cWW  cW-W
  14 A.G20          A.U54          G-U Wobble       28-XXVIII cWW  cW-W
  15 A.G21          A.C53          G-C WC           19-XIX    cWW  cW-W
  16 A.U22          A.A39          U-A WC           20-XX     cWW  cW-W
  17 A.C23          A.G38          C-G WC           19-XIX    cWW  cW-W
  18 A.G24          A.U37          G-U Wobble       28-XXVIII cWW  cW-W
  19 A.C25          A.G36          C-G WC           19-XIX    cWW  cW-W
  20 A.U26          A.A35          U-A WC           20-XX     cWW  cW-W
  21 A.G27          A.C34          G-C WC           19-XIX    cWW  cW-W
  22 A.C28          A.G33          C-G WC           19-XIX    cWW  cW-W
  23 A.U29          A.G32          U+G --           --        tSW  tm+W

List of 1 coaxial stack
   1 Helix#1 contains 3 stems: [#1,#2,#3]

Loops

DSSR identifies two hairpin loops, one internal loop, and a [0,8,0] 3-way junction loop by default. As shown in the secondary structure depicted in the upper-left corner of the figure above, these results are evident. When excluding the two isolated canonical base pairs from consideration of secondary structures, DSSR identifies one hairpin loop composed of four nucleotides (U29 to G32), a bulge made up of thirteen nucleotides (G40 to G52), and an internal loop consisting of seven nucleotides on one strand (A7 to G13) and two nucleotides on the other strand (G61 and G62), precisely as described in the Stafflinger et al. (2025) paper.

The literature is inconsistent in its treatment of isolated canonical base pairs within RNA secondary structures. For instance, as detailed in the DSSR User Manual (Figure 3B), considering the isolated WC C−G pair (between C2658 and G2663) reveals the reported GUAA tetraloop (Correll et al., 2003) in PDB entry 1msy and a [5,4] asymmetric internal loop. Without this consideration, the tetraloop and internal loop delineated by the C−G pair merge, resulting in an enlarged hairpin loop spanning 17 nucleotides (from C2652 to G2668).

G-quadruplex

In the class V GTP aptamer-GTP complex structure (PDB entry: 9hrf), the two G-tetrads are formed by guanine nucleotides originating from two loop regions separated by an eight-base-pair A-form stem. This arrangement results in a complex and previously unobserved G-quadruplex topology. DSSR easily identifies the two G-tetrads that form a G4-helix (but not a G4-stem), which is defined by stacking interactions of G4-tetrads, regardless of backbone connectivity. In principle, a G4-helix may include more than one G4-stem via coaxial stacking interactions. The G4 helix/stem are defined in a similar manner to the double-stranded helix/stem as described above.

The relevant DSSR output is provided below. Observe the varying glycosidic bond patterns and groove dimensions, along with two non-G4-stem loops that include two terminal guanosines, which align with Figure 2B of Stafflinger et al. (2025).

List of 1 G4-helix
  Note: a G4-helix is defined by stacking interactions of G4-tetrads, regardless
        of backbone connectivity, and may contain more than one G4-stem.
  helix#1[0] layers=2 INTRA-molecular
   1  glyco-bond=---- sugar=---3 groove=---- WC-->Major nts=4 GgGG A.G12,A.GTP100,A.G42,A.G46
   2  glyco-bond=-s-- sugar=-3-3 groove=wn-- WC-->Major nts=4 GGGG A.G13,A.G40,A.G43,A.G47
    step#1  pm(>>,forward)  area=7.84  rise=3.35 twist=32.6
    strand#1 RNA glyco-bond=-- sugar=-- nts=2 GG A.G12,A.G13
    strand#2 RNA glyco-bond=-s sugar=-3 nts=2 gG A.GTP100,A.G40
    strand#3 RNA glyco-bond=-- sugar=-- nts=2 GG A.G42,A.G43
    strand#4 RNA glyco-bond=-- sugar=33 nts=2 GG A.G46,A.G47

****************************************************************************
List of 2 non-stem G4 loops (INCLUDING the two terminal nts)
   1 type=lateral   helix=#1 nts=28 GUAGGUCGGUCGCUGCUUCGGCAGUGAG A.G13,A.U14,A.A15,A.G16,A.G17,A.U18,A.C19,A.G20,A.G21,A.U22,A.C23,A.G24,A.C25,A.U26,A.G27,A.C28,A.U29,A.U30,A.C31,A.G32,A.G33,A.C34,A.A35,A.G36,A.U37,A.G38,A.A39,A.G40
   2 type=V-shaped  helix=#1 nts=4 GGGG A.G40,A.G41,A.G42,A.G43

Pseudoknots

DSSR identifies one pseudoknot in the structure (PDB entry: 9hrf), enabled by the long-range U10-A45 WC pair (see the upper-right panel of the figure above). In literature, pseudoknots are defined by crossing WC pairs. However, in this structure, it is important to note the two synergistic G12+G46 and G13+G47 pairs within two layers of G-tetrads. The two loop regions are thus held tightly together through both pseudoknot and G-quadruplex formation. This observation suggests that the definition of pseudoknots may need to be expanded to include non-canonical pairs.

References

  1. Stafflinger H, Neißner K, Bartsch S, Pichler AK, Bartosik K, Dhamotharan K, et al. Crystal structure of the class V GTP-binding RNA aptamer bound to its ligand: GTP recognition by a topologically complex intermolecular G-quadruplex. Nucleic Acids Research. 2025;53:gkaf1315. https://doi.org/10.1093/nar/gkaf1315.
  2. Correll CC. The common and the distinctive features of the bulged-G motif based on a 1.04 A resolution RNA structure. Nucleic Acids Research. 2003;31:6806–18. https://doi.org/10.1093/nar/gkg908.
---

Comment

 
---

·

Thank you for printing this article from http://x3dna.org/. Please do not forget to visit back for more 3DNA-related information. — Xiang-Jun Lu